 |
 |
|
|
| Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
| hsa_circ_0000414 | |||
| Gene | IRAK3 | Organism | Human |
| Genome Locus | chr12:66597490-66605377:+ | Build | hg19 |
| Disease | Pulmonary Tuberculosis | ICD-10 | Respiratory tuberculosis, bacteriologically and histologically confirmed (A15) |
| DBLink | Link to database | PMID | 29248507 |
| Experimental Method | |||
| Sample Type | Peripheral Blood Mononuclear Cells (PBMCs) | Comparison | Two subjects with Active Pulmonary Tuberculosis (APTB) and two age- and gender-matched healthy controls |
| Method for Estimation | Quantitative PCR | PCR Details | |
| Primers (Experimented) | Forward GGAGAAGGAGAGATTTTTGAGG ReverseGTGCCCAGGACCAAAGTAAT | Statistics | Fold Change : Downregulated pvalue : p<0.05 |
| Citation | |||
| Qian, Z, Liu, H, Li, M, Shi, J, Li, N, Zhang, Y, Zhang, X, Lv, J, Xie, X, Bai, Y, Ge, Q, Ko, EA, Tang, H, Wang, T, Wang, X, Wang, Z, Zhou, T, Gu, W (2018). Potential Diagnostic Power of Blood Circular RNA Expression in Active Pulmonary Tuberculosis. EBioMedicine, 27:18-26. | |||